| Common name: | Tbx3 |
| X. tropicalis clone name: | TTpA012g23 |
| Accession: | BX703861.1 |
Morpholino-1 | |
| MO sequence | CTGGATCTCTCATGGGTAAATTCAT |
| Phenotype | Embryos exhibit a delay at the onset of gastrulation, however they develop normally to tadpole stage except that they have a wavy tail. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | NORMAL BODY LENGTH WAVY TAIL |
MO-1 phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Morpholino-2 | |
| MO sequence | TCACTTGCACCCTTTGGATCTCACA |
| Phenotype | Embryos exhibit a delay in the onset of gastrulation and are dead by stage 28. They appear to die during gastrulation/neurulation |
| Phenotypic Class | SHORT AXIS |
| Synphenotype Group | GASTRULA OR NEURULA DEFECTS |
MO-2 phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control.2 - gastrula | control.2 - tailbud | control.2 - tadpole | |
|
|
|
|
|
| morpholino.2 - gastrula | morpholino.2 - tailbud | morpholino.2 - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |