MO phenotypes
| Common name: | Serpina1 |
| X. tropicalis clone name: | TTpA011h07 |
| Accession: | BX704113.1 |
Morpholino | |
| MO sequence | CAAAATGTAAGGAAGACCCCTCATC |
| Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/10.5) and by tailbud stage they have a shortened axis. At tadpole stage embryos have failed to extend normally along the A-P axis normally and shortened tails. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
|
|
|
|
Expression data |
|||
|---|---|---|---|
 |
 |
 |
 |
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
|
|
|
|