MO phenotypes
| Common name: | Mu1b |
| X. tropicalis clone name: | TTbA033a09 |
| Accession: | CF224028.1 |
Morpholino | |
| MO sequence | ATATACACGGCGGAGGCTGACATAC |
| Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/10.5). At tailbud stage 40% of embryos are slightly shortened along the A-P axis but the rest look apparently normal. By tadpole stage embryos have a shortened axis and a variety of tissue defects most noticeably in tail development. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | NORMAL BODY LENGTH WAVY TAIL |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
|
|
|
|
Expression data |
|||
|---|---|---|---|
 |
 |
 |
 |
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
|
|
|
|