| Common name: | PAR6B | 
| X. tropicalis clone name: | TNeu127e06 | 
| Accession: | CR760394.2 | 
Morpholino  | |
| MO sequence | GTGCCCCCGGTTCATGTTGCCAGTG | 
| Phenotype | Embryos do not exhibit a delay in the onset of gastrulation (10/11) however 90% are dead or dying by stage 28 and appear to have died during gastrulation/neurulation. | 
| Phenotypic Class | SHORT AXIS | 
| Synphenotype Group | GASTRULA OR NEURULA DEFECTS | 
MO phenotypes |     
|||
|---|---|---|---|
| 
 | 
 | 
 | 
|
| control - gastrula | control - tailbud | control - tadpole | |
| 
 | 
 | 
 | 
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data | 
|||
|---|---|---|---|
| 
 | 
 | 
 | 
 | 
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |