MO phenotypes
| Common name: | Mu2 |
| X. tropicalis clone name: | TNeu123l16 |
| Accession: | AL802310.2 |
Morpholino | |
| MO sequence | TATATGAACAGTCCCCCAATCATGG |
| Phenotype | Embryos develop apparently normally through gastrulation to tailbud stage. However, at tadpole stage they exhibit a shortened axis due to reduction in tail length, reduced melanocytes and also heart defects associated with ventral oedema. |
| Phenotypic Class | SHORT AXIS |
| Synphenotype Group | NORMAL BODY SHORT TAIL |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
|
|
|
|
Expression data |
|||
|---|---|---|---|
 |
 |
 |
 |
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
|
|
|
|