| Common name: | PAR6A | 
| X. tropicalis clone name: | TNeu123j18 | 
| Accession: | CR855473.2 | 
Morpholino  | |
| MO sequence | GGACTTACTGAAGCTGCGGTTCATC | 
| Phenotype | Embryos develop apparently normally through gastrulation but by tailbud stage they exhibit a short A-P axis and are ventralised. At tadpole stage embryos have under developed, bent down tails and have a variety of tissue defects including ventral tissue expansions. | 
| Phenotypic Class | BENT AXIS | 
| Synphenotype Group | BENT DOWN TAIL | 
MO phenotypes |     
|||
|---|---|---|---|
| 
 | 
 | 
 | 
|
| control - gastrula | control - tailbud | control - tadpole | |
| 
 | 
 | 
 | 
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data | 
|||
|---|---|---|---|
| 
 | 
 | 
 | 
 | 
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |