Common name: | PAR6A |
X. tropicalis clone name: | TNeu123j18 |
Accession: | CR855473.2 |
Morpholino | |
MO sequence | GGACTTACTGAAGCTGCGGTTCATC |
Phenotype | Embryos develop apparently normally through gastrulation but by tailbud stage they exhibit a short A-P axis and are ventralised. At tadpole stage embryos have under developed, bent down tails and have a variety of tissue defects including ventral tissue expansions. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT DOWN TAIL |
MO phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |