Common name: | novel |
X. tropicalis clone name: | TNeu123g11 |
Accession: | CR761938.2 |
Morpholino | |
MO sequence | GGGAACAGCTCTCTCTGTCATGTTT |
Phenotype | Embryos develop apparently normally through gastrulation to tailbud stage. However, at tadpole stage 55% of embryos appear smaller than the control embryos. |
Phenotypic Class | SHORT AXIS |
Synphenotype Group | PROPORTIONATELY SMALL |
MO phenotypes |
|||
---|---|---|---|
![]() |
![]() |
![]() |
|
control - gastrula | control - tailbud | control - tadpole | |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
![]() |
![]() |
![]() |
![]() |
Expression data |
|||
---|---|---|---|
![]() |
![]() |
![]() |
![]() |
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
![]() |
![]() |
![]() |
![]() |