| Common name: | Wnt8 |
| X. tropicalis clone name: | TNeu118d19 |
| Accession: | CR760475.2 |
Morpholino-1 | |
| MO sequence | GGAGACTGCTATCCAGGGTAATGCT |
| Phenotype | Embryos begin gastrulation normally but by tailbud stage have a variety of tissue defects including ventral tissue/gut defects. At tadpole stage embryos exhibit defective head and ventral tissue/gut development. |
| Phenotypic Class | VENTRAL DEFECT |
| Synphenotype Group | NORMAL LENGTH VENTRAL REDUCTION |
MO-1 phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Morpholino-2 | |
| MO sequence | GACAAACAAAGTGGTGTTCTTCATG |
| Phenotype | No observable phenotype |
| Phenotypic Class | NO OBSERVED PHENOTYPE |
| Synphenotype Group | NO OBSERVED PHENOTYPE |
MO-2 phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control.2 - gastrula | control.2 - tailbud | control.2 - tadpole | |
|
|
|
|
|
| morpholino.2 - gastrula | morpholino.2 - tailbud | morpholino.2 - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |