| Common name: | novel |
| X. tropicalis clone name: | TNeu109g23 |
| Accession: | AL875318.2 |
Morpholino | |
| MO sequence | AGTGCAGATGTCACAAATAAGCATG |
| Phenotype | Embryos exhibit a delay in the onset of gastrulation and by tailbud stage are delayed and have defects in axial extension. At the tadpole stage embryos are generally of normal length but have wavy bent tails. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | NORMAL BODY LENGTH WAVY TAIL |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |