Common name: | novel |
X. tropicalis clone name: | TNeu104f22 |
Accession: | AL660492.2 |
Morpholino | |
MO sequence | AACAGCTCTCTCTGTCATGTTTATG |
Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/10.5) and by tailbud stage they have a shortened axis with both head and tailbud defects. At tadpole stage embryos have failed to extend along the A-P axis normally and exhibit a variety of defects. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
---|---|---|---|
![]() |
![]() |
![]() |
|
control - gastrula | control - tailbud | control - tadpole | |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
![]() |
![]() |
![]() |
![]() |
Expression data |
|||
---|---|---|---|
![]() |
![]() |
![]() |
![]() |
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
![]() |
![]() |
![]() |
![]() |