Common name: | Cdx2; CAD2 |
X. tropicalis clone name: | TNeu087f10 |
Accession: | CR760338.2 |
Morpholino | |
MO sequence | ATCCAAAAGATAACCCACGTACATC |
Phenotype | Embryos appear to develop normally but by tailbud stage they exhibit a shortened A-P axis due to defects in tail development. |
Phenotypic Class | SHORT AXIS |
Synphenotype Group | NORMAL BODY SHORT TAIL |
MO phenotypes |
|||
---|---|---|---|
![]() |
![]() |
![]() |
|
control - gastrula | control - tailbud | control - tadpole | |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
![]() |
![]() |
![]() |
![]() |
Expression data |
|||
---|---|---|---|
![]() |
![]() |
![]() |
![]() |
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
![]() |
![]() |
![]() |
![]() |