| Common name: | Cdx2; CAD2 | 
| X. tropicalis clone name: | TNeu087f10 | 
| Accession: | CR760338.2 | 
| Morpholino | |
| MO sequence | ATCCAAAAGATAACCCACGTACATC | 
| Phenotype | Embryos appear to develop normally but by tailbud stage they exhibit a shortened A-P axis due to defects in tail development. | 
| Phenotypic Class | SHORT AXIS | 
| Synphenotype Group | NORMAL BODY SHORT TAIL | 
| MO phenotypes | |||
|---|---|---|---|
|   |   |   | |
| control - gastrula | control - tailbud | control - tadpole | |
|  |  |  |  | 
|   |   |   | |
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
|  |  |  |  | 
| Expression data | |||
|---|---|---|---|
|   |   |   |   | 
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole | 
|  |  |  |  |