| Common name: | Cdx2; CAD2 |
| X. tropicalis clone name: | TNeu087f10 |
| Accession: | CR760338.2 |
Morpholino | |
| MO sequence | ATCCAAAAGATAACCCACGTACATC |
| Phenotype | Embryos appear to develop normally but by tailbud stage they exhibit a shortened A-P axis due to defects in tail development. |
| Phenotypic Class | SHORT AXIS |
| Synphenotype Group | NORMAL BODY SHORT TAIL |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |