| Common name: | novel |
| X. tropicalis clone name: | TNeu062k05 |
| Accession: | CR848314.2 |
Morpholino-1 | |
| MO sequence | GTTCTGTGCTAAAGCAGCTCATGTC |
| Phenotype | Embryos develop apparently normally through gastrulation but by tailbud stage they exhibit a delay in development. At tadpole stage embryos have a pronounced tail defect where their tails bend downward. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO-1 phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Morpholino-2 | |
| MO sequence | CGGCTCCGGTCTGAAGCGC |
| Phenotype | Embryos develop apparently normally through gastrulation but by tailbud stage they exhibit a delay in development. At tadpole stage embryos have a variety of tissue defects particularly in head, somite and tail development exhibiting a bent up tail. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT DOWN TAIL |
MO-2 phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control.2 - gastrula | control.2 - tailbud | control.2 - tadpole | |
|
|
|
|
|
| morpholino.2 - gastrula | morpholino.2 - tailbud | morpholino.2 - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |