| Common name: | Bmp4 |
| X. tropicalis clone name: | TNeu045c17 |
| Accession: | CR761955.1 |
Morpholino | |
| MO sequence | CAGCATTCGGTTACCAGGAATCATG |
| Phenotype | Embryos appear to develop normally but by tailbud stage they exhibit shortened posteriors and ventral tissue defects. At tadpole stage embryos exhibit ventral oedema and tail defects. |
| Phenotypic Class | VENTRAL DEFECT |
| Synphenotype Group | NORMAL LENGTH; VENTRAL OEDEMA |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |