| Common name: | novel; zn domain |
| X. tropicalis clone name: | TGas143j10 |
| Accession: | CR848612.2 |
Morpholino | |
| MO sequence | GCCGCTCCATGTTTGTATTATAGGC |
| Phenotype | Embryos exhibit a slight delay at the onset of gastrulation. By tadpole stage embryos are short with defects in head, dorsal tissue and posterior development. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |