Common name: | novel; zn domain |
X. tropicalis clone name: | TGas143j10 |
Accession: | CR848612.2 |
Morpholino | |
MO sequence | GCCGCTCCATGTTTGTATTATAGGC |
Phenotype | Embryos exhibit a slight delay at the onset of gastrulation. By tadpole stage embryos are short with defects in head, dorsal tissue and posterior development. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |