| Common name: | novel | 
| X. tropicalis clone name: | TGas141c24 | 
| Accession: | CR761833.2 | 
Morpholino  | |
| MO sequence | GATCTCGTTCTGCCATATTAGAGCG | 
| Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/10.5) but appear to develop normally to tailbud stage. However, as they develop further their trunks and tails are less well developed than control embryos and their tails are bent down | 
| Phenotypic Class | BENT AXIS | 
| Synphenotype Group | BENT DOWN TAIL | 
MO phenotypes |     
|||
|---|---|---|---|
| 
 | 
 | 
 | 
|
| control - gastrula | control - tailbud | control - tadpole | |
| 
 | 
 | 
 | 
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data | 
|||
|---|---|---|---|
| 
 | 
 | 
 | 
 | 
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |