Common name: | novel |
X. tropicalis clone name: | TGas141c24 |
Accession: | CR761833.2 |
Morpholino | |
MO sequence | GATCTCGTTCTGCCATATTAGAGCG |
Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/10.5) but appear to develop normally to tailbud stage. However, as they develop further their trunks and tails are less well developed than control embryos and their tails are bent down |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT DOWN TAIL |
MO phenotypes |
|||
---|---|---|---|
![]() |
![]() |
![]() |
|
control - gastrula | control - tailbud | control - tadpole | |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
![]() |
![]() |
![]() |
![]() |
Expression data |
|||
---|---|---|---|
![]() |
![]() |
![]() |
![]() |
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
![]() |
![]() |
![]() |
![]() |