| Common name: | novel |
| X. tropicalis clone name: | TGas141c24 |
| Accession: | CR761833.2 |
Morpholino | |
| MO sequence | GATCTCGTTCTGCCATATTAGAGCG |
| Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/10.5) but appear to develop normally to tailbud stage. However, as they develop further their trunks and tails are less well developed than control embryos and their tails are bent down |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT DOWN TAIL |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |