| Common name: | Hox-7.1;Msx1 |
| X. tropicalis clone name: | TGas131h15 |
| Accession: | CR855795.2 |
Morpholino | |
| MO sequence | ATATCCGAGCTGGGAAGTTACAGCG |
| Phenotype | Embryos appear to develop normally but by the late tailbud stage embryos injected with 30 ng of MO begin to exhibit tail defects. By tadpole stage these embryos have pronounced defects in tail development and motiltiy as do 70% of embryos injected with 10 ng of MO. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | NORMAL BODY LENGTH WAVY TAIL |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |