| Common name: | Dachshund2-like with gill expression |
| X. tropicalis clone name: | TGas128i12 |
| Accession: | AL959426.2 |
Morpholino | |
| MO sequence | TTAAAGCCTCCTGCTCCATTAGTGG |
| Phenotype | Embryos commence gastrulation normally but by tailbud stage embryos are delayed and exhibit head and tailbud development defects. At tadpole stage embryos exhibit microencephaly and defects in branchial arch, eye and neural tube development and have a wavy tail. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | NORMAL BODY LENGTH WAVY TAIL |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |