Common name: | fgfr3;cek2 |
X. tropicalis clone name: | TGas092f08 |
Accession: | AL964086.2 |
Morpholino-1 | |
MO sequence | CAGCCTTAGACATCCTCTGGTCGCA |
Phenotype | Embryos appear to develop normally but by tailbud stage they exhibit a delay in development and reduced posteriors and anterior-dorsal tissue development defects. By tadpole stages embryos exhibit a variety of tissue defects including microencephaly and posterior truncations . |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO-1 phenotypes |
|||
---|---|---|---|
![]() |
![]() |
![]() |
|
control - gastrula | control - tailbud | control - tadpole | |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
![]() |
![]() |
![]() |
![]() |
Morpholino-2 | |
MO sequence | TGCAGAACAGGGTGACCATTCCCAT |
Phenotype | Embryos appear to develop normally but by tailbud stage they exhibit a delay in development and reduced posteriors and anterior-dorsal tissue development defects. By tadpole stages embryos exhibit a variety of tissue defects including posterior truncations . |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO-2 phenotypes |
|||
---|---|---|---|
![]() |
![]() |
![]() |
|
control.2 - gastrula | control.2 - tailbud | control.2 - tadpole | |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|
morpholino.2 - gastrula | morpholino.2 - tailbud | morpholino.2 - tadpole | |
![]() |
![]() |
![]() |
![]() |
Expression data |
|||
---|---|---|---|
![]() |
![]() |
![]() |
![]() |
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
![]() |
![]() |
![]() |
![]() |