| Common name: | RxRbeta |
| X. tropicalis clone name: | TGas080l23 |
| Accession: | CR926364.2 |
Morpholino | |
| MO sequence | TCTGGCATACCCGACTGTCTCCCAT |
| Phenotype | Embryos appear to commence gastrulation normally but by tailbud stage they exhibit a delay in development and exhibit posterior truncations. At tadpole stages embryos appear shorter than controls and have a bent body axis with a short bent up tail. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |