Common name: | RxRbeta |
X. tropicalis clone name: | TGas080l23 |
Accession: | CR926364.2 |
Morpholino | |
MO sequence | TCTGGCATACCCGACTGTCTCCCAT |
Phenotype | Embryos appear to commence gastrulation normally but by tailbud stage they exhibit a delay in development and exhibit posterior truncations. At tadpole stages embryos appear shorter than controls and have a bent body axis with a short bent up tail. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |