Common name: | novel; nop 7 associated 1 |
X. tropicalis clone name: | TGas076f10 |
Accession: | CR761697.2 |
Morpholino | |
MO sequence | CGTGATTCCGAGCAGGCGCTGCCAT |
Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/10.5) and subsequent development. By tadpole stage embryos are smaller than controls and exhibit defects in tail development. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |