| Common name: | novel; nop 7 associated 1 |
| X. tropicalis clone name: | TGas076f10 |
| Accession: | CR761697.2 |
Morpholino | |
| MO sequence | CGTGATTCCGAGCAGGCGCTGCCAT |
| Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/10.5) and subsequent development. By tadpole stage embryos are smaller than controls and exhibit defects in tail development. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |