| Common name: | novel |
| X. tropicalis clone name: | TGas076c07 |
| Accession: | CT030100.2 |
Morpholino | |
| MO sequence | GGTGAGTGCCCACACACCCTCCCAT |
| Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/10.5). At tailbud stage embryos are shortened along the A-P axis most prominently in the posterior, but they also exhibit anterior defects. By tadpole stage all embryos have a shortened axis and appear smaller than control embryos. |
| Phenotypic Class | SHORT AXIS |
| Synphenotype Group | PROPORTIONATELY SMALL |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |