Common name: | novel |
X. tropicalis clone name: | TGas076c07 |
Accession: | CT030100.2 |
Morpholino | |
MO sequence | GGTGAGTGCCCACACACCCTCCCAT |
Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/10.5). At tailbud stage embryos are shortened along the A-P axis most prominently in the posterior, but they also exhibit anterior defects. By tadpole stage all embryos have a shortened axis and appear smaller than control embryos. |
Phenotypic Class | SHORT AXIS |
Synphenotype Group | PROPORTIONATELY SMALL |
MO phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |