| Common name: | cD1LIC | 
| X. tropicalis clone name: | TGas061b15 | 
| Accession: | CT030328.1 | 
| Morpholino-1 | |
| MO sequence | CGGTACGCCCGGTTGCCATCCTCTA | 
| Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/11). All embryos are dead by stage 28 and appear to have died during gastrulation/neurulation | 
| Phenotypic Class | GASTRULA | 
| Synphenotype Group | GASTRULA DEFECTS | 
| MO-1 phenotypes | |||
|---|---|---|---|
|   |   |   | |
| control - gastrula | control - tailbud | control - tadpole | |
|  |  |  |  | 
|   |   |   | |
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
|  |  |  |  | 
| Morpholino-2 | |
| MO sequence | CTCTTCTGGTGAGCAGGAGGATGAT | 
| Phenotype | Embryos exhibit a delay during gastrulation and by tailbud stage 72% exhibit a delay in development. By tadpole stages embryos have a shortened A-P axis and exhibit a variety of defects. | 
| Phenotypic Class | BENT AXIS | 
| Synphenotype Group | BENT UP TAIL OR ARCHED BACK | 
| MO-2 phenotypes | |||
|---|---|---|---|
|   |   |   | |
| control.2 - gastrula | control.2 - tailbud | control.2 - tadpole | |
|  |  |  |  | 
|   |   |   | |
| morpholino.2 - gastrula | morpholino.2 - tailbud | morpholino.2 - tadpole | |
|  |  |  |  | 
| Expression data | |||
|---|---|---|---|
|   |   |   |   | 
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole | 
|  |  |  |  |