Common name: | cD1LIC |
X. tropicalis clone name: | TGas061b15 |
Accession: | CT030328.1 |
Morpholino-1 | |
MO sequence | CGGTACGCCCGGTTGCCATCCTCTA |
Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/11). All embryos are dead by stage 28 and appear to have died during gastrulation/neurulation |
Phenotypic Class | GASTRULA |
Synphenotype Group | GASTRULA DEFECTS |
MO-1 phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Morpholino-2 | |
MO sequence | CTCTTCTGGTGAGCAGGAGGATGAT |
Phenotype | Embryos exhibit a delay during gastrulation and by tailbud stage 72% exhibit a delay in development. By tadpole stages embryos have a shortened A-P axis and exhibit a variety of defects. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO-2 phenotypes |
|||
---|---|---|---|
control.2 - gastrula | control.2 - tailbud | control.2 - tadpole | |
morpholino.2 - gastrula | morpholino.2 - tailbud | morpholino.2 - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |