| Common name: | novel |
| X. tropicalis clone name: | TGas055a16 |
| Accession: | CR761559.2 |
Morpholino-1 | |
| MO sequence | CTAGCGGCTTCTTCTTCCTGTCCAT |
| Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/11). All embryos are dead by stage 28 and appear to have died during gastrulation/neurulation |
| Phenotypic Class | GASTRULA |
| Synphenotype Group | GASTRULA DEFECTS |
MO-1 phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Morpholino-2 | |
| MO sequence | TGCGAGGAAGATACCTAGTAATGCT |
| Phenotype | Embryos develop apparently normally through gastrulation to tailbud stage. However, at tadpole stage they have a very bent A-P axis such that the tail has a wavy appearance in embryos injected with 30 ng of MO. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | NORMAL BODY LENGTH WAVY TAIL |
MO-2 phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control.2 - gastrula | control.2 - tailbud | control.2 - tadpole | |
|
|
|
|
|
| morpholino.2 - gastrula | morpholino.2 - tailbud | morpholino.2 - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |