Common name: | cD2LC |
X. tropicalis clone name: | TGas050a15 |
Accession: | CR761866.2 |
Morpholino | |
MO sequence | GATCACAGCTTTTCTCTCAGACATG |
Phenotype | Embryos appear to develop normally but by tadpole stage embryos swim in circles and have a curved body axis |
Phenotypic Class | CURVED BODY AXIS |
Synphenotype Group | CURVED BODY AXIS |
MO phenotypes |
|||
---|---|---|---|
![]() |
![]() |
![]() |
|
control - gastrula | control - tailbud | control - tadpole | |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
![]() |
![]() |
![]() |
![]() |
Expression data |
|||
---|---|---|---|
![]() |
![]() |
![]() |
![]() |
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
![]() |
![]() |
![]() |
![]() |