| Common name: | cD2LC |
| X. tropicalis clone name: | TGas050a15 |
| Accession: | CR761866.2 |
Morpholino | |
| MO sequence | GATCACAGCTTTTCTCTCAGACATG |
| Phenotype | Embryos appear to develop normally but by tadpole stage embryos swim in circles and have a curved body axis |
| Phenotypic Class | CURVED BODY AXIS |
| Synphenotype Group | CURVED BODY AXIS |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |