Common name: | eed |
X. tropicalis clone name: | TGas047c23 |
Accession: | CR848605.2 |
Morpholino | |
MO sequence | CATGTTCCTCCGCCGAGACGTGACG |
Phenotype | Embryos appear to commence gastrulation normally but by tailbud stage they exhibit a shortened A-P axis due most notably to posterior truncations and are ventralised. At tadpole stages embryos exhibit a variety of tissue defects along the A-P axis. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |