| Common name: | eed |
| X. tropicalis clone name: | TGas047c23 |
| Accession: | CR848605.2 |
Morpholino | |
| MO sequence | CATGTTCCTCCGCCGAGACGTGACG |
| Phenotype | Embryos appear to commence gastrulation normally but by tailbud stage they exhibit a shortened A-P axis due most notably to posterior truncations and are ventralised. At tadpole stages embryos exhibit a variety of tissue defects along the A-P axis. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |