MO phenotypes
| Common name: | Lefty-b |
| X. tropicalis clone name: | TGas031a08 |
| Accession: | AL649862.2 |
Morpholino | |
| MO sequence | CACCCATCTTGCTGTGACAGTGATC |
| Phenotype | Embryos appear to commence gastrulation normally but by tadpole stage they exhibit a shortened and bent A-P axis and the have a delayed developmental rate relative to control embryos. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT DOWN TAIL |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
|
|
|
|
Expression data |
|||
|---|---|---|---|
 |
 |
 |
 |
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
|
|
|
|