Common name: | Cdc42 |
X. tropicalis clone name: | TGas029e03 |
Accession: | BX727142.1 |
Morpholino | |
MO sequence | CTACACATTTAATTGTCTGCATGGC |
Phenotype | Embryos commence gastrulation normally but by tailbud stage 60% of embryos have died during gastrula/neurula stages. 50% of the remaining embryos exhibit a shortened axis and at tadpole stage embryos injected at the higher dose have a reduced body size and particularly shortened tail |
Phenotypic Class | SHORT AXIS |
Synphenotype Group | PROPORTIONATELY SMALL |
MO phenotypes |
|||
---|---|---|---|
![]() |
![]() |
![]() |
|
control - gastrula | control - tailbud | control - tadpole | |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
![]() |
![]() |
![]() |
![]() |
Expression data |
|||
---|---|---|---|
![]() |
![]() |
![]() |
![]() |
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
![]() |
![]() |
![]() |
![]() |