| Common name: | Cdc42 |
| X. tropicalis clone name: | TGas029e03 |
| Accession: | BX727142.1 |
Morpholino | |
| MO sequence | CTACACATTTAATTGTCTGCATGGC |
| Phenotype | Embryos commence gastrulation normally but by tailbud stage 60% of embryos have died during gastrula/neurula stages. 50% of the remaining embryos exhibit a shortened axis and at tadpole stage embryos injected at the higher dose have a reduced body size and particularly shortened tail |
| Phenotypic Class | SHORT AXIS |
| Synphenotype Group | PROPORTIONATELY SMALL |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |