Common name: | DOC-1 |
X. tropicalis clone name: | TGas028g07 |
Accession: | AL652680.2 |
Morpholino | |
MO sequence | ATGGGCTTATACGACATGCTTTAAC |
Phenotype | Embryos appear to commence gastrulation normally although they appear to proceed through gastrulation or neurulation abnormally. By tailbud stage they exhibit a shortened A-P axis. At tadpole stage embryos exhibit a variety of tissue defects and embryos injected with 30 ng have an arrested development from mid to late tailbud stages. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
---|---|---|---|
![]() |
![]() |
![]() |
|
control - gastrula | control - tailbud | control - tadpole | |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
![]() |
![]() |
![]() |
![]() |
Expression data |
|||
---|---|---|---|
![]() |
![]() |
![]() |
![]() |
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
![]() |
![]() |
![]() |
![]() |