MO phenotypes
| Common name: | DOC-1 |
| X. tropicalis clone name: | TGas028g07 |
| Accession: | AL652680.2 |
Morpholino | |
| MO sequence | ATGGGCTTATACGACATGCTTTAAC |
| Phenotype | Embryos appear to commence gastrulation normally although they appear to proceed through gastrulation or neurulation abnormally. By tailbud stage they exhibit a shortened A-P axis. At tadpole stage embryos exhibit a variety of tissue defects and embryos injected with 30 ng have an arrested development from mid to late tailbud stages. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
|
|
|
|
Expression data |
|||
|---|---|---|---|
 |
 |
 |
 |
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
|
|
|
|