Common name: | Dnalc4 |
X. tropicalis clone name: | TGas020f13 |
Accession: | CR762240.2 |
Morpholino-1 | |
MO sequence | TCTTGCTTTCGCCAGGATCTGCCAT |
Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/10.5). At tailbud stage embryos are shortened along the A-P axis and exhibit a variety of tissue defects. By tadpole stage all surviving embryos are short with bent tails and heart defects. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO-1 phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Morpholino-2 | |
MO sequence | GGCGATTCCTCGTCAGCTCCAAGTG |
Phenotype | No observable phenotype |
Phenotypic Class | NO OBSERVED PHENOTYPE |
Synphenotype Group | NO OBSERVED PHENOTYPE |
MO-2 phenotypes |
|||
---|---|---|---|
control.2 - gastrula | control.2 - tailbud | control.2 - tadpole | |
morpholino.2 - gastrula | morpholino.2 - tailbud | morpholino.2 - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |