| Common name: | Dnalc4 |
| X. tropicalis clone name: | TGas020f13 |
| Accession: | CR762240.2 |
Morpholino-1 | |
| MO sequence | TCTTGCTTTCGCCAGGATCTGCCAT |
| Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/10.5). At tailbud stage embryos are shortened along the A-P axis and exhibit a variety of tissue defects. By tadpole stage all surviving embryos are short with bent tails and heart defects. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO-1 phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Morpholino-2 | |
| MO sequence | GGCGATTCCTCGTCAGCTCCAAGTG |
| Phenotype | No observable phenotype |
| Phenotypic Class | NO OBSERVED PHENOTYPE |
| Synphenotype Group | NO OBSERVED PHENOTYPE |
MO-2 phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control.2 - gastrula | control.2 - tailbud | control.2 - tadpole | |
|
|
|
|
|
| morpholino.2 - gastrula | morpholino.2 - tailbud | morpholino.2 - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |