Common name: | Wnt5b |
X. tropicalis clone name: | TGas012b13 |
Accession: | CR760740.2 |
Morpholino-1 | |
MO sequence | CAGTAGTCGCAGAATTCCCGTCATG |
Phenotype | Embryos develop normally at the onset of gastrulation. However, by tailbud stage they are have a very short axis and are ventralised although most tissues appear to have developed normally. At tadpole stages embryos are slightly shorter than controls with ventral oedema. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT DOWN TAIL |
MO-1 phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Morpholino-2 | |
MO sequence | AATTCCCGTCATGCTGCTCCTCTCC |
Phenotype | Embryos exhibit a delay in the onset of gastrulation and are dead by stage 28. They appear to die during gastrulation/neurulation |
Phenotypic Class | GASTRULA |
Synphenotype Group | GASTRULA DEFECTS |
MO-2 phenotypes |
|||
---|---|---|---|
control.2 - gastrula | control.2 - tailbud | control.2 - tadpole | |
morpholino.2 - gastrula | morpholino.2 - tailbud | morpholino.2 - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |