Common name: | HP1beta |
X. tropicalis clone name: | TEgg130i17 |
Accession: | CR760924.2 |
Morpholino | |
MO sequence | TTTCTTGTTCTGCTTCTTTCCCATG |
Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/11). All embryos are dead by stage 28 and appear to have died during gastrulation/neurulation |
Phenotypic Class | GASTRULA |
Synphenotype Group | GASTRULA DEFECTS |
MO phenotypes |
|||
---|---|---|---|
![]() |
![]() |
![]() |
|
control - gastrula | control - tailbud | control - tadpole | |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
![]() |
![]() |
![]() |
![]() |
Expression data |
|||
---|---|---|---|
![]() |
![]() |
![]() |
![]() |
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
![]() |
![]() |
![]() |
![]() |