MO phenotypes
| Common name: | Smad2 |
| X. tropicalis clone name: | TEgg118f13 |
| Accession: | AL867605.2 |
Morpholino | |
| MO sequence | GGTAAATGGCAAAATGGAGGACATG |
| Phenotype | Embryos exhibit a delay in the onset of gastrulation by tailbud stage have a short A-P axis, are ventralised and have a variety of tissue defects. At tadpole stage embryos remain shorter than controls, exhibit a delay in development and either posterior truncations or have a very short bent up tail. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | NORMAL BODY LENGTH WAVY TAIL |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
|
|
|
|
Expression data |
|||
|---|---|---|---|
 |
 |
 |
 |
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
|
|
|
|