Common name: | ST13; novel |
X. tropicalis clone name: | TEgg110h11 |
Accession: | CR942468.2 |
Morpholino | |
MO sequence | GCGGGTCCATAATGAAGGAGAAATG |
Phenotype | Embryos appear to start gastrulation normally but by tailbud stage have a short A-P axis, are ventralised and have a variety of tissue defects. At tadpole stage embryos remain shorter than controls, exhibit a delay in development and have a very short bent up tail and either a reduction in ventral tissue mass or enlarged anterior structures. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |