Common name: | novel |
X. tropicalis clone name: | TEgg098o12 |
Accession: | AL865292.2 |
Morpholino | |
MO sequence | AGGCACTGGCAAATCAAAGCCATTG |
Phenotype | Embryos injected with 10 ng of MO are relatively unaffected, however embryos injected at the 30 ng dose exhibit a delay in development and by tadpole stage they are short and exhibit a variety of defects along the A-P axis. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |