MO phenotypes
| Common name: | novel |
| X. tropicalis clone name: | TEgg098o12 |
| Accession: | AL865292.2 |
Morpholino | |
| MO sequence | AGGCACTGGCAAATCAAAGCCATTG |
| Phenotype | Embryos injected with 10 ng of MO are relatively unaffected, however embryos injected at the 30 ng dose exhibit a delay in development and by tadpole stage they are short and exhibit a variety of defects along the A-P axis. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
|
|
|
|
Expression data |
|||
|---|---|---|---|
 |
 |
 |
 |
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
|
|
|
|