MO-1 phenotypes
| Common name: | novel |
| X. tropicalis clone name: | TEgg078i21 |
| Accession: | AL878749.2 |
Morpholino-1 | |
| MO sequence | CAACAAGCTATGGGCCAACTCCATG |
| Phenotype | Embryos appear to commence gastrulation normally but by tadpole stage they exhibit a shortened and bent A-P axis and have begun to degrade. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT DOWN TAIL |
MO-1 phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
|
|
|
|
Morpholino-2 | |
| MO sequence | CCATGATGGCTCTACTGTTCACCAA |
| Phenotype | Embryos appear to commence gastrulation normally but by tadpole stage they exhibit a shortened and bent A-P axis and have begun to degrade. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO-2 phenotypes |
|||
|---|---|---|---|
 |
 |
 |
|
| control.2 - gastrula | control.2 - tailbud | control.2 - tadpole | |
|
|
|
|
 |
 |
 |
|
| morpholino.2 - gastrula | morpholino.2 - tailbud | morpholino.2 - tadpole | |
|
|
|
|
Expression data |
|||
|---|---|---|---|
 |
 |
 |
 |
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
|
|
|
|