Common name: | novel |
X. tropicalis clone name: | TEgg078i21 |
Accession: | AL878749.2 |
Morpholino-1 | |
MO sequence | CAACAAGCTATGGGCCAACTCCATG |
Phenotype | Embryos appear to commence gastrulation normally but by tadpole stage they exhibit a shortened and bent A-P axis and have begun to degrade. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT DOWN TAIL |
MO-1 phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Morpholino-2 | |
MO sequence | CCATGATGGCTCTACTGTTCACCAA |
Phenotype | Embryos appear to commence gastrulation normally but by tadpole stage they exhibit a shortened and bent A-P axis and have begun to degrade. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO-2 phenotypes |
|||
---|---|---|---|
control.2 - gastrula | control.2 - tailbud | control.2 - tadpole | |
morpholino.2 - gastrula | morpholino.2 - tailbud | morpholino.2 - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |