Common name: | ARP6 |
X. tropicalis clone name: | TEgg077g12 |
Accession: | CR760917.1 |
Morpholino | |
MO sequence | GTTGTCCAGAACAAGTGTGGTCATC |
Phenotype | Embryos commence gastrulation normally but by tailbud stage embryos exhibit a shortened A-P axis. By tadpole stage embryos exhibit a variety of defects including a bent/curved body axis and motility and tail defects. |
Phenotypic Class | CURVED BODY AXIS |
Synphenotype Group | CURVED BODY AXIS |
MO phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |