| Common name: | ARP6 |
| X. tropicalis clone name: | TEgg077g12 |
| Accession: | CR760917.1 |
Morpholino | |
| MO sequence | GTTGTCCAGAACAAGTGTGGTCATC |
| Phenotype | Embryos commence gastrulation normally but by tailbud stage embryos exhibit a shortened A-P axis. By tadpole stage embryos exhibit a variety of defects including a bent/curved body axis and motility and tail defects. |
| Phenotypic Class | CURVED BODY AXIS |
| Synphenotype Group | CURVED BODY AXIS |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |