| Common name: | Anillin |
| X. tropicalis clone name: | TEgg065g11 |
| Accession: | AL860870.2 |
Morpholino | |
| MO sequence | TGCAGCATCTTGTTCCGAGGCTGGG |
| Phenotype | Embryos exhibit a delay in the onset of gastrulation (10/11). All embryos are dead by stage 28 and appear to have died during gastrulation/neurulation |
| Phenotypic Class | SHORT AXIS |
| Synphenotype Group | GASTRULA OR NEURULA DEFECTS |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |