MO-1 phenotypes
| Common name: | novel |
| X. tropicalis clone name: | TEgg061a13 |
| Accession: | CR761145.2 |
Morpholino-1 | |
| MO sequence | ACTTTGCGTTTCATCTTCACATTAG |
| Phenotype | Embryos develop apparently normally through gastrulation but by tailbud stage they exhibit a delay in development. At tadpole stage embryos are short and have a variety of tissue defects particularly in head, somite, tail and ventral tissue development exhibiting a ventral constriction. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO-1 phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
|
|
|
|
Morpholino-2 | |
| MO sequence | TTTATAGGCTGTGCTGAAGTGAAAC |
| Phenotype | No observable phenotype |
| Phenotypic Class | NO OBSERVED PHENOTYPE |
| Synphenotype Group | NO OBSERVED PHENOTYPE |
MO-2 phenotypes |
|||
|---|---|---|---|
 |
 |
 |
|
| control.2 - gastrula | control.2 - tailbud | control.2 - tadpole | |
|
|
|
|
 |
 |
 |
|
| morpholino.2 - gastrula | morpholino.2 - tailbud | morpholino.2 - tadpole | |
|
|
|
|
Expression data |
|||
|---|---|---|---|
 |
 |
 |
 |
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
|
|
|
|