Common name: | novel |
X. tropicalis clone name: | TEgg061a13 |
Accession: | CR761145.2 |
Morpholino-1 | |
MO sequence | ACTTTGCGTTTCATCTTCACATTAG |
Phenotype | Embryos develop apparently normally through gastrulation but by tailbud stage they exhibit a delay in development. At tadpole stage embryos are short and have a variety of tissue defects particularly in head, somite, tail and ventral tissue development exhibiting a ventral constriction. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO-1 phenotypes |
|||
---|---|---|---|
![]() |
![]() |
![]() |
|
control - gastrula | control - tailbud | control - tadpole | |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
![]() |
![]() |
![]() |
![]() |
Morpholino-2 | |
MO sequence | TTTATAGGCTGTGCTGAAGTGAAAC |
Phenotype | No observable phenotype |
Phenotypic Class | NO OBSERVED PHENOTYPE |
Synphenotype Group | NO OBSERVED PHENOTYPE |
MO-2 phenotypes |
|||
---|---|---|---|
![]() |
![]() |
![]() |
|
control.2 - gastrula | control.2 - tailbud | control.2 - tadpole | |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|
morpholino.2 - gastrula | morpholino.2 - tailbud | morpholino.2 - tadpole | |
![]() |
![]() |
![]() |
![]() |
Expression data |
|||
---|---|---|---|
![]() |
![]() |
![]() |
![]() |
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
![]() |
![]() |
![]() |
![]() |