Common name: | Zn Domain |
X. tropicalis clone name: | TEgg040a13 |
Accession: | CR762039.2 |
Morpholino | |
MO sequence | GCTGCTTCTTCTTCTTTCTTCCCAT |
Phenotype | Embryos exhibit a delay in the onset of gastrulation and are dead by stage 28. They appear to die during gastrulation/neurulation |
Phenotypic Class | GASTRULA |
Synphenotype Group | GASTRULA DEFECTS |
MO phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |