Common name: | Smad10 |
X. tropicalis clone name: | TEgg032k01 |
Accession: | CT025227.1 |
Morpholino | |
MO sequence | AGCTCCAGGCTGGCAAACGCCATCT |
Phenotype | Embryos begin gastrulation normally but by tailbud stage have a short A-P axis and a variety of tissue defects. At tadpole stage embryos remain shorter than controls, exhibit a delay in development and have a bent down tail. |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT DOWN TAIL |
MO phenotypes |
|||
---|---|---|---|
control - gastrula | control - tailbud | control - tadpole | |
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
---|---|---|---|
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |