| Common name: | Smad10 |
| X. tropicalis clone name: | TEgg032k01 |
| Accession: | CT025227.1 |
Morpholino | |
| MO sequence | AGCTCCAGGCTGGCAAACGCCATCT |
| Phenotype | Embryos begin gastrulation normally but by tailbud stage have a short A-P axis and a variety of tissue defects. At tadpole stage embryos remain shorter than controls, exhibit a delay in development and have a bent down tail. |
| Phenotypic Class | BENT AXIS |
| Synphenotype Group | BENT DOWN TAIL |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |