| Common name: | Aurora A |
| X. tropicalis clone name: | TEgg021k02 |
| Accession: | CR760668.2 |
Morpholino | |
| MO sequence | CTTTAACAGCCCGTTCCATTATATG |
| Phenotype | Embryos appear to develop normally but by tadpole stage embryos swim in circles and a few have a mildly bent body axis. |
| Phenotypic Class | MOTILITY DEFECTS |
| Synphenotype Group | SWIMMING IN CIRCLES |
MO phenotypes |
|||
|---|---|---|---|
|
|
|
|
|
| control - gastrula | control - tailbud | control - tadpole | |
|
|
|
|
|
| morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
Expression data |
|||
|---|---|---|---|
|
|
|
|
|
| expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |