Common name: | Par3B |
X. tropicalis clone name: | TEgg004p11 |
Accession: | AL849138.2 |
Morpholino | |
MO sequence | TCCCAAAGCAAACGGTTACTTTCAT |
Phenotype | Embryos exhibit a delay in the onset of gastrulation (10.5/11.5). At tailbud stage embryos are ventralised and shortened along the A-P axis exhibiting a variety of tissue defects. By tadpole stage embryos only 25% of embryos have survived and are shortened, exhibiting multiple defects along the A-P axis |
Phenotypic Class | BENT AXIS |
Synphenotype Group | BENT UP TAIL OR ARCHED BACK |
MO phenotypes |
|||
---|---|---|---|
![]() |
![]() |
![]() |
|
control - gastrula | control - tailbud | control - tadpole | |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|
morpholino - gastrula | morpholino - tailbud | morpholino - tadpole | |
![]() |
![]() |
![]() |
![]() |
Expression data |
|||
---|---|---|---|
![]() |
![]() |
![]() |
![]() |
expression - gastrula | expression - neurula | expression - tailbud | expression - tadpole |
![]() |
![]() |
![]() |
![]() |